National Center of Plant Gene Research (Wuhan)
Welcome, 1!

View or edit personal profile, password, etc...   Help documents

Back home
General information of the research and database
Search in Rice Mutants Database
BLAST against Rice Mutants Database
Hotspot links
Suggestions
Contact us

a. Order mutants     b .Expression Pattern Lines Help
02Z15AO78
General information
This line was generated from rice cultivar Zhonghua 15.
Reporter gene: GUS.
Seed status: available.
Morphology
No visible morphological mutation was detected.
Flanking Sequence
 
  • Entry_ prefix Types
  •  

    ATL

    ATosL

    ATosR

    ITL

    ITR

     

    TTL

    TTR

    TTosL

    TTosR

    HTL

  • Entry_postfix Types (different primer id)
  •  

    AC1

    ADS-2

    LBT2

    TRB2

    ULB3

     

    XLB3

    XRB3

    URB4

    PFRB4

    NTLB5

     

    TosRS

    SP6

    T7

     

     

  • Additional remarks for Entry_prefix
  •   The first letter means methods for flanking sequence
    ⊕A: Adaptor-PCR ⊕T: TAIL-PCR ⊕I: Inverse-PCR ⊕H: Hi TAIL-PCR
    The middle letters means TAGs
    ⊕T: T-DNA ⊕Tos: Tos17
    The last letter means Left or Right
  • Mutant phenotype(s) mentioned in this entry may not be necessarily linked to the gene(s) identified by the following flanking       sequence(s) due to possible multiple insertions.
  • Blue color is used for rice genomic sequence and orange for vector sequence. Black color is used for neither vector nor rice       genomic sequence that could be caused by recombination.
  •  
    TTL _02Z15AO78 _NTLB5
    Sequence1|Possible location: Chromosome 1 (by Guo Dong)
    CTTAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTCGTTAGCTGTACATAAATTCTTTAAATTATGATGTC
    TTGGGACAAAGATCATCGCCTTAATATGGTTGGACATTAAGAGTAGTTAGTAATATAATATAATACGATCACATATAGTA
    TAATATCCTTGGAGCAAGTTCGTGATGATGAGGATATAGAGGTCGAACGGGCAGTTTGTAAATCTACGGATGTGTGAGCT
    ATGTGAATTATATTATTAATAAGAGAATTAATTTTGATCATTTTTTCCTACGACCTTATAATATCAATCTTAGACCTAGG
    GAGAGACATCCCTCCGAACATTTTTTATAAAACAATTGTGAGCAATTTAGATATTGAACACGAGACCTTAGGGTTGAAAC
    TACACATCTTTTGCCACTACACTATCAAGTGCATCTCAATTTTGGACCTCAAGCTTATTCTTTTTAACGGACAGGCCATC
    ACCGACGATTTATATTAAGAATAAGGTGTCCTATTTTAAGGAGTAAACGAGACCAAACCTTACAGTGCCCAGTTAATTTG
    GGAAAAATGAGCAAACCATAATTACAACACCTCACCAACAGCTAATCTAACCTAAGCTACCACGACGGAACCGACACAAG
    GCATCTGCCAAGTTTATCATAGAGACGACACAATAGCCCACATATGTTATCGTTGCCAAGCTTGCCACCCAAGCGACACA
    ACAGCTTCGACTTCACTGCAATGCTACTCCAACACAAAAACTCGAAA
    © 2019 All Rights Reserved, National Center of Plant Gene Research (Wuhan).
    Recommend: 1024*768, IE6.0/Netscape7.0 or higher Constructed by Zhang Jianwei
    Update by Zhang Chengjun, E-mail:rmd_order@mail.hzau.edu.cn
    鄂ICP备05018538号